| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.214018 |
| Chromosome: | chromosome 16 |
| Location: | 2841655 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663400 | LCI11A,BST2,LCI11 | Bestrophin 2; (1 of 10) PF01062 - Bestrophin, RFP-TM, chloride channel (Bestrophin) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGACGCGAATAGTGGGGAGAGAGAGCAA |
| Internal bar code: | TCTAACGGTGCTCCCGGGATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1110 |
| LEAP-Seq percent confirming: | 99.3394 |
| LEAP-Seq n confirming: | 7820 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTTGCCGTTCCTGTCTCT |
| Suggested primer 2: | GAATGCACTCTACGTCGCAA |