Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.214720 |
Chromosome: | chromosome 7 |
Location: | 4871384 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g346050 | CRD1,CHL27A | Copper response defect 1 protein; (1 of 2) 1.14.13.81 - Magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase / Mg-protoporphyrin IX monomethyl ester oxidative cyclase | 5'UTR|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGACAAGGGACAGAACCCCGGGCAGCGCG |
Internal bar code: | CCGACTTGTGCAAAACTAATTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 731 |
LEAP-Seq percent confirming: | 99.4356 |
LEAP-Seq n confirming: | 3171 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGCAAGCACCACAAAATCA |
Suggested primer 2: | AAGCTTGCTTCTGTGTCGGT |