| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.214720 |
| Chromosome: | chromosome 7 |
| Location: | 4871388 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g346050 | CRD1,CHL27A | Copper response defect 1 protein; (1 of 2) 1.14.13.81 - Magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase / Mg-protoporphyrin IX monomethyl ester oxidative cyclase | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTGATCACCCGTCTCTAATCTGGAAGGT |
| Internal bar code: | CCGGACGCCGGAAACCCAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 996 |
| LEAP-Seq percent confirming: | 99.6806 |
| LEAP-Seq n confirming: | 5306 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCAAGCACCACAAAATCA |
| Suggested primer 2: | AAGCTTGCTTCTGTGTCGGT |