Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.215794 |
Chromosome: | chromosome 6 |
Location: | 5086062 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g280700 | (1 of 2) PF10197 - N-terminal domain of CBF1 interacting co-repressor CIR (Cir_N) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGATGCCGGGCTCCCCGGGGTTAGCAGC |
Internal bar code: | TAATAGCCAGCACTCTTCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 310 |
LEAP-Seq percent confirming: | 99.6687 |
LEAP-Seq n confirming: | 2106 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTCCTCCTCCTCCTTCTT |
Suggested primer 2: | ACCATTGCTGGTACTCCGTC |