| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.215907 |
| Chromosome: | chromosome 2 |
| Location: | 1997309 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088400 | DEG1,DEG1A | (1 of 3) PTHR22939:SF81 - PROTEASE DO-LIKE 1, CHLOROPLASTIC; Deg protease | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGCCACGTACCGGTGACACCAGGGCGC |
| Internal bar code: | TGACATCCGACCTGACCTCTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 835 |
| LEAP-Seq percent confirming: | 99.6026 |
| LEAP-Seq n confirming: | 9776 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGTCGACCTTTCCAAAAA |
| Suggested primer 2: | GCAAGTACGAGAGCCTACCG |