| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.216130 |
| Chromosome: | chromosome 2 |
| Location: | 5455426 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g107750 | PCD1 | Polyketide cyclase/dehydrase; (1 of 4) PF03364 - Polyketide cyclase / dehydrase and lipid transport (Polyketide_cyc) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCGGGTCACTGGGTCCGTGCGCATCATC |
| Internal bar code: | TTGCTTTGTGGATTATCGTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 657 |
| LEAP-Seq percent confirming: | 80.2569 |
| LEAP-Seq n confirming: | 7374 |
| LEAP-Seq n nonconfirming: | 1814 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCAGAGGGTGGTGAGAAG |
| Suggested primer 2: | TCTGGGTATGGTGATGCTGA |