| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.216720 |
| Chromosome: | chromosome 2 |
| Location: | 4283040 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099055 | (1 of 18) PTHR19862:SF14 - WD REPEAT-CONTAINING PROTEIN 48 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGCGTGGCCTTAAGCAAGTAAGATGATG |
| Internal bar code: | AAGGCCACCGCGGTCGCGCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 383 |
| LEAP-Seq percent confirming: | 77.0686 |
| LEAP-Seq n confirming: | 2282 |
| LEAP-Seq n nonconfirming: | 679 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTGATGTTTGCAGCATT |
| Suggested primer 2: | CGTGCAGGACAACTACTCCA |