| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.216979 |
| Chromosome: | chromosome 7 |
| Location: | 2482626 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329300 | MSC1 | Mechanosensitive ion channel; (1 of 1) PTHR30221 - SMALL-CONDUCTANCE MECHANOSENSITIVE CHANNEL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGGCTCCAGGCCATGGGGTAGAGTTGAT |
| Internal bar code: | CCGTTCAATCGGGCCCCCGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 932 |
| LEAP-Seq percent confirming: | 99.2681 |
| LEAP-Seq n confirming: | 7867 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTAATAAGCGCGCCAAG |
| Suggested primer 2: | TTATAGGAACGCATGAGGGG |