| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.217055 |
| Chromosome: | chromosome 9 |
| Location: | 1606302 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397400 | SDR17 | Short-chain dehydrogenase/reductase; (1 of 1) 1.1.1.300//1.3.1.33 - NADP-retinol dehydrogenase / Retinol dehydrogenase (NADP(+)) // Protochlorophyllide reductase / Protochlorophyllide oxidoreductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTTCCGAACGAAGGAAGATACGAGCGC |
| Internal bar code: | TGCCGGGTTGTTTTCTGAGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 805 |
| LEAP-Seq percent confirming: | 91.8919 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTTACGCGCTCATGTCAG |
| Suggested primer 2: | GGATGACTTGTGACGTGTGG |