| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.217623 |
| Chromosome: | chromosome 11 |
| Location: | 1332193 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467712 | SAGA1 | StArch Granules Abnormal 1; (1 of 3) IPR000104//IPR002044//IPR013784 - Antifreeze protein, type I // Carbohydrate binding module family 20 // Carbohydrate-binding-like fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGAGTTCTGGGTTCTGAAAGCGTAGGCG |
| Internal bar code: | GAACTGACAGCAATGGCTCAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 920 |
| LEAP-Seq percent confirming: | 97.3348 |
| LEAP-Seq n confirming: | 8984 |
| LEAP-Seq n nonconfirming: | 246 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGATGGAGATGGATGCGAT |
| Suggested primer 2: | GTCGTGCGAATTGGTTAGGT |