Insertion junction: LMJ.RY0402.217875_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.217875
Chromosome:chromosome_6
Location:5346714
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g283500 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ACAAACGCCTTGCGGAAGCCCCTGTAAGCC
Internal bar code:CGTCGACGTTGCCCCGCGAAAC

Confirmation - LEAP-Seq

LEAP-Seq distance:296
LEAP-Seq percent confirming:99.4813
LEAP-Seq n confirming:3452
LEAP-Seq n nonconfirming:18
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:GCAACCTTCAGAGAACAGCC
Suggested primer 2:GCCCTTATCTGGGCCTATTC