| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.219264 |
| Chromosome: | chromosome 12 |
| Location: | 377661 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g494100 | SPL19 | Pre-mRNA splicing factor; (1 of 1) K12828 - splicing factor 3B subunit 1 (SF3B1, SAP155) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCATCAACACCGGCCAAGAACCATGTA |
| Internal bar code: | CAGCGTAGCGTCTTCTTGCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 489 |
| LEAP-Seq percent confirming: | 95.5273 |
| LEAP-Seq n confirming: | 16830 |
| LEAP-Seq n nonconfirming: | 788 |
| LEAP-Seq n unique pos: | 76 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGCGCTAATGAAGCTTGT |
| Suggested primer 2: | CGTGCCTCAGCCCTATAGTC |