| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.219976 |
| Chromosome: | chromosome 14 |
| Location: | 1027441 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g614400 | SRH23 | (1 of 1) K15711 - SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A3 [EC:3.6.4.- 6.3.2.19] (SMARCA3, HLTF); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGAGGAATGTGAGTGTCAGGGATGGAG |
| Internal bar code: | CCAAAAAGGTTTAGAGTTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 378 |
| LEAP-Seq percent confirming: | 97.8261 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTTCTGCGTCTTCCTTGC |
| Suggested primer 2: | GACTTTTCAGCATCATCGCA |