| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.220739 |
| Chromosome: | chromosome 14 |
| Location: | 3341985 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630000 | KIR2 | putative ketoacid isomerase-like protein; (1 of 7) PF12680 - SnoaL-like domain (SnoaL_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATCATGCGTGTGGGCTATCTACCTAGC |
| Internal bar code: | AGGTAAGGACGTCTGGGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 692 |
| LEAP-Seq percent confirming: | 99.425 |
| LEAP-Seq n confirming: | 1729 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTTGGGCTGTTTCAAGT |
| Suggested primer 2: | TAAGTCGACAAAGATCGGGG |