| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.224463 |
| Chromosome: | chromosome 11 |
| Location: | 3434112 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480950 | (1 of 10) PF00505 - HMG (high mobility group) box (HMG_box); High mobility group protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGATGAGCGCACGCAAAGCGCACCTGTT |
| Internal bar code: | AACTTTCTAGCGCTAAGAGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 624 |
| LEAP-Seq percent confirming: | 98.5069 |
| LEAP-Seq n confirming: | 2705 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTTGGGCTTTAAGGTGCC |
| Suggested primer 2: | ATTTCCGCACTTATCAACCG |