Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.224538 |
Chromosome: | chromosome 8 |
Location: | 4106476 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g379650 | TIC20 | 20 kDa translocon at the inner membrane of chloroplasts | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGGCCGCCGCTGCGAAGCGCTAACCGC |
Internal bar code: | AAACACGTACTATCAGGCCCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1194 |
LEAP-Seq percent confirming: | 99.4384 |
LEAP-Seq n confirming: | 37361 |
LEAP-Seq n nonconfirming: | 211 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATGATCCTCCCCTGACTC |
Suggested primer 2: | CGTTCACCATGCACCACTAC |