| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.224632 |
| Chromosome: | chromosome 12 |
| Location: | 2011152 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510200 | BLZ9 | bZIP transcription factor; (1 of 21) IPR004827 - Basic-leucine zipper domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCACATCAAACATTCCGCGGCAGGTGG |
| Internal bar code: | ACTTCCGCACGTGGCGTAGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 220 |
| LEAP-Seq percent confirming: | 95.2174 |
| LEAP-Seq n confirming: | 219 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCAGCAAAATGAGGACAA |
| Suggested primer 2: | CAACCAGGGCCAGTATCAGT |