| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.225432 |
| Chromosome: | chromosome 2 |
| Location: | 744840 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g078507 | (1 of 1) IPR006311//IPR025585 - Twin-arginine translocation pathway, signal sequence // Photosystem II Pbs27 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCCAGCTAACTCCCAGCTAACTCCCA |
| Internal bar code: | GCGTGGGCTCTGCGTCCTTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1073 |
| LEAP-Seq percent confirming: | 99.4949 |
| LEAP-Seq n confirming: | 5122 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCTGTGACAACCTGTGG |
| Suggested primer 2: | TAAAGTTCCTTCACCACCCG |