| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.225716 |
| Chromosome: | chromosome 4 |
| Location: | 3732574 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229300 | RCA1 | (1 of 4) IPR003959//IPR027417 - ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase; RuBisCO activase 1, chloroplastic | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGGCAAAACTGGCAGGGGGGGCCTTCAC |
| Internal bar code: | GACTTGCGTTTGCTTTGCATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1159 |
| LEAP-Seq percent confirming: | 99.3446 |
| LEAP-Seq n confirming: | 5457 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGATCAAGTACGGCAAG |
| Suggested primer 2: | GCCTGGAACACAAGTTGGAT |