| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.226354 |
| Chromosome: | chromosome 6 |
| Location: | 5432649 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284200 | LHCBM9 | (1 of 6) K08912 - light-harvesting complex II chlorophyll a/b binding protein 1 (LHCB1); Light-harvesting Chlorophyll a/b binding protein of LHCII | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACCGCGATGCCCAGCAGAGCCAACCGCA |
| Internal bar code: | GGGCAGCAGGGGGCATCGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 831 |
| LEAP-Seq percent confirming: | 99.2892 |
| LEAP-Seq n confirming: | 3492 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCCATCTTTGCTAGTGGG |
| Suggested primer 2: | CCGCTAATGCATGCTGACTA |