| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.226666 |
| Chromosome: | chromosome 10 |
| Location: | 3101900 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441650 | (1 of 1) PF06650//PF16908 - SHR-binding domain of vacuolar-sorting associated protein 13 (SHR-BD) // Vacuolar sorting-associated protein 13, N-terminal (VPS13) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGTAACGCTCACCCAGGAGCTGGCCAA |
| Internal bar code: | TCGCAAGAGGATGCTGGGACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 799 |
| LEAP-Seq percent confirming: | 99.4993 |
| LEAP-Seq n confirming: | 4571 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGACAGCACCACCATCTT |
| Suggested primer 2: | CGTTGCGGAATAGTTACCGT |