Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.226711 |
Chromosome: | chromosome 9 |
Location: | 542357 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403900 | FAP294 | (1 of 5) PF13391 - HNH endonuclease (HNH_2); Coiled-Coil Flagellar Associated Protein 294 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGTTTGCTCCGGACTAAACACCTGCAG |
Internal bar code: | GGAGGTACATCGGCCCAGCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 642 |
LEAP-Seq percent confirming: | 95.9184 |
LEAP-Seq n confirming: | 1128 |
LEAP-Seq n nonconfirming: | 48 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCAGCATAGCCTTGCTTAG |
Suggested primer 2: | GCAACACAACAGCAAGAGGA |