| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.226871 |
| Chromosome: | chromosome 12 |
| Location: | 1358495 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488500 | ARC6 | Accumulation and replication of chloroplast; (1 of 2) PTHR33925//PTHR33925:SF3 - FAMILY NOT NAMED // PROTEIN ACCUMULATION AND REPLICATION OF CHLOROPLASTS 6, CHLOROPLASTIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCGCTGCCGCGTACTCTGCGGACACCC |
| Internal bar code: | ACGGGGTAGAGTGGTGGGGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 516 |
| LEAP-Seq percent confirming: | 99.7862 |
| LEAP-Seq n confirming: | 2800 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACATGCTCTCCAAATCCC |
| Suggested primer 2: | AGGACCCCATACTTCCATCC |