| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.227172 |
| Chromosome: | chromosome 1 |
| Location: | 1830874 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g009900 | CDJ3 | Chloroplast DnaJ-like protein 3; (1 of 2) IPR001080//IPR001623//IPR017896 - 3Fe-4S ferredoxin // DnaJ domain // 4Fe-4S ferredoxin-type, iron-sulphur binding domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAAGCAAGTGCAGCTGTCGGGACCCTTC |
| Internal bar code: | TTACCGTGTGGATTAGTTGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1152 |
| LEAP-Seq percent confirming: | 99.2992 |
| LEAP-Seq n confirming: | 6943 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTAGTAGCCCTGGTTGTGGG |
| Suggested primer 2: | TGCAATTTTAGTGCAGGCAG |