| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228111 |
| Chromosome: | chromosome 1 |
| Location: | 4224274 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g028200 | DBP2,HEL6 | (1 of 1) PTHR24031:SF219 - ATP-DEPENDENT RNA HELICASE DDX5-RELATED; DEAD-box RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTCGTGCGCGTGCGTGGGGTACAGGGCC |
| Internal bar code: | GTGGGCATAGCCGCCTGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 626 |
| LEAP-Seq percent confirming: | 99.2238 |
| LEAP-Seq n confirming: | 1534 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTGACATACCTGGTGCT |
| Suggested primer 2: | TGGTTGCAGTGCTTCTTGTC |