Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.228119 |
Chromosome: | chromosome 8 |
Location: | 2047625 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g368450 | (1 of 1) K12667 - oligosaccharyltransferase complex subunit delta (ribophorin II) (SWP1, RPN2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGGCGGATGACGATGGCACCGTGCCAA |
Internal bar code: | GCGAACGCCATGTTGTGGACAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 618 |
LEAP-Seq percent confirming: | 76.1538 |
LEAP-Seq n confirming: | 99 |
LEAP-Seq n nonconfirming: | 31 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGGGACAGGATGACGACT |
Suggested primer 2: | TGGAGACGTGAGTGCGATAG |