Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.228322 |
Chromosome: | chromosome 12 |
Location: | 7539880 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g555700 | DNJ15 | DnaJ-like protein; (1 of 5) IPR000104//IPR001623 - Antifreeze protein, type I // DnaJ domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACACGATACATGTGGTCACCGGATGTCC |
Internal bar code: | CCGTCCCGGATGGCCAGTGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 690 |
LEAP-Seq percent confirming: | 97.9667 |
LEAP-Seq n confirming: | 12479 |
LEAP-Seq n nonconfirming: | 259 |
LEAP-Seq n unique pos: | 148 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGGCTTAAGGGAGAGCTT |
Suggested primer 2: | ACCAGGGTGTGGTTTACGTC |