Insertion junction: LMJ.RY0402.228556_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.228556
Chromosome:chromosome_3
Location:3050043
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g164250 FAP262 Flagellar Associated Protein, protein kinase sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TCGTCCTTCGCCTCCTTGCCAGCCGAAGGC
Internal bar code:CAGGGTGACCGTTGGTTTATAA

Confirmation - LEAP-Seq

LEAP-Seq distance:391
LEAP-Seq percent confirming:99.6196
LEAP-Seq n confirming:3404
LEAP-Seq n nonconfirming:13
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:GACCTGGAGCTGGACTTCCT
Suggested primer 2:GAGACTGCCCAGAAGCAATC