Insertion junction: LMJ.RY0402.228556_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.228556
Chromosome:chromosome_3
Location:3050044
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g164250 FAP262 Flagellar Associated Protein, protein kinase sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GAGGTGGAAGTCGCTGCTGCGGAGTAGGCG
Internal bar code:CTGCCCGCCAAGAAATACGGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:709
LEAP-Seq percent confirming:98.9317
LEAP-Seq n confirming:15095
LEAP-Seq n nonconfirming:163
LEAP-Seq n unique pos:200

Suggested primers for confirmation by PCR

Suggested primer 1:GACCTGGAGCTGGACTTCCT
Suggested primer 2:GAGACTGCCCAGAAGCAATC