| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228912 |
| Chromosome: | chromosome 14 |
| Location: | 1927477 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g621000 | SPL27 | Pre-mRNA splicing factor; (1 of 1) K12869 - crooked neck (CRN, CRNKL1, CLF1, SYF3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTCGCCCGCGCCCGCGAACCGCGACATG |
| Internal bar code: | GCGCAAGCAAACTCTAAAAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 79 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACTGAGCGAGCATAACCA |
| Suggested primer 2: | CCCCCTCCCAAGATAAACAT |