| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.228962 |
| Chromosome: | chromosome 9 |
| Location: | 7151104 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g412000 | (1 of 26) IPR013026//IPR019734 - Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAGCCGGAGCAAGAAGCGACCTCGCGCG |
| Internal bar code: | CCCTGCGCGTCCGCTAGCATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 345 |
| LEAP-Seq percent confirming: | 84.6667 |
| LEAP-Seq n confirming: | 254 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCATCCTTACCCTTCAT |
| Suggested primer 2: | GGAGTGTTTGAAGCGAGGAC |