| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.229225 |
| Chromosome: | chromosome 9 |
| Location: | 2060362 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394150 | RAA1,OPR40 | psaA mRNA trans-splicing factor; (1 of 3) PF06743 - FAST kinase-like protein, subdomain 1 (FAST_1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGGGGTCTGCTGCCGCTGCTCTGGACAG |
| Internal bar code: | GATTGATTGAACGGCGGGCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 330 |
| LEAP-Seq percent confirming: | 81.9154 |
| LEAP-Seq n confirming: | 1608 |
| LEAP-Seq n nonconfirming: | 355 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCCAGGTATGCCACTAGC |
| Suggested primer 2: | GCTATCCTTGCCACCTTCAC |