| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.229399 |
| Chromosome: | chromosome 13 |
| Location: | 2248409 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g578650 | CPLD10,NUOAF5,HCF173 | (1 of 1) PTHR10366//PTHR10366:SF343 - NAD DEPENDENT EPIMERASE/DEHYDRATASE // SUBFAMILY NOT NAMED; PSII biogenesis protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGACGTCTCTTAGAACCGCGCAAAATAAG |
| Internal bar code: | ATCAAGGGCAGGGCATGCCCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 738 |
| LEAP-Seq percent confirming: | 96.0254 |
| LEAP-Seq n confirming: | 1208 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCACTGCGCTTCTAAAAA |
| Suggested primer 2: | CAATGCCATGTATGAGCTGG |