| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.229511 |
| Chromosome: | chromosome 16 |
| Location: | 7279219 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683371 | ODC2 | (1 of 2) 4.1.1.17 - Ornithine decarboxylase / L-ornithine carboxy-lyase; Ornithine decarboxylase 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAAGCATTGTTAGGGCGAGCAAACTAGC |
| Internal bar code: | GGGCGTAGCGTTTTTATTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 541 |
| LEAP-Seq percent confirming: | 63.1206 |
| LEAP-Seq n confirming: | 7666 |
| LEAP-Seq n nonconfirming: | 4479 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTCACCATAAAGTGCGTT |
| Suggested primer 2: | TAGGTTTGTCTACACGGCCC |