| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.230333 |
| Chromosome: | chromosome 12 |
| Location: | 3581209 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g513700 | HEL52 | DEAD box ATP-dependent RNA helicase; (1 of 1) K14808 - ATP-dependent RNA helicase DDX54/DBP10 [EC:3.6.4.13] (DDX54, DBP10) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGTCGTCGCCGTATCGACAACGAAATA |
| Internal bar code: | CACAGTGCCTCACTGCCGCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 197 |
| LEAP-Seq percent confirming: | 98.3222 |
| LEAP-Seq n confirming: | 1465 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCACTACCTGCCAAGCCTA |
| Suggested primer 2: | GTACCGCATGTTCTGTGGTG |