Insertion junction: LMJ.RY0402.231268_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.231268
Chromosome:chromosome_13
Location:2134076
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g577950 VPS60 Subunit of the ESCRT-III complex antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GTCGGGAATAGCTGAGAGCAGATCCCAACA
Internal bar code:TCTGGATATGAAGGACAATTAA

Confirmation - LEAP-Seq

LEAP-Seq distance:465
LEAP-Seq percent confirming:99.1054
LEAP-Seq n confirming:2991
LEAP-Seq n nonconfirming:27
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:CTTGTTCTTCTTGAAGGCGG
Suggested primer 2:CATGTATCAGTCGGACACGG