Insertion junction: LMJ.RY0402.231469_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.231469
Chromosome:chromosome_3
Location:3047862
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g164250 FAP262 Flagellar Associated Protein, protein kinase sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGGTATCTACAGCCCCATCCCCCGCCTGC
Internal bar code:TTATAGCGTACGGTAAATTTCG

Confirmation - LEAP-Seq

LEAP-Seq distance:660
LEAP-Seq percent confirming:80.8025
LEAP-Seq n confirming:5417
LEAP-Seq n nonconfirming:1287
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:CATGGTGATGAAGTGCAAGG
Suggested primer 2:GTCGCGGTACACCATTTTCT