Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.232697 |
Chromosome: | chromosome 3 |
Location: | 6396304 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g194200 | PDH2 | Pyruvate dehydrogenase E1 beta subunit; (1 of 1) PTHR11624//PTHR11624:SF76 - DEHYDROGENASE RELATED // PYRUVATE DEHYDROGENASE E1 COMPONENT SUBUNIT BETA-2, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCAGCCCCGCTAACCAGCGCCAGCACT |
Internal bar code: | GCACGGCGTCGGGCCTATGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 464 |
LEAP-Seq percent confirming: | 89.7129 |
LEAP-Seq n confirming: | 375 |
LEAP-Seq n nonconfirming: | 43 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGTACTTCCAGTCCATCCC |
Suggested primer 2: | AGAAGATGATGGGGTTGTCG |