Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.233447 |
Chromosome: | chromosome 3 |
Location: | 4559601 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g176833 | NAP1,NAP,DII5 | (1 of 7) PF00022 - Actin (Actin); Novel actin protein 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGATGGATGGGTCGGCGGTCAAAGCG |
Internal bar code: | AGCCGGTTCCACGATCAACGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 718 |
LEAP-Seq percent confirming: | 99.0017 |
LEAP-Seq n confirming: | 2876 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACCGCATCATGTTCGTAA |
Suggested primer 2: | GTGGGGTAGTCCAAAGCTCA |