Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.234711 |
Chromosome: | chromosome 7 |
Location: | 6272852 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g356750 | (1 of 2) PTHR10926 - CELL CYCLE CONTROL PROTEIN 50 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCACACCGTCGCCCGGCCATTGTTTTGC |
Internal bar code: | TATACTTGGTGAGACTCTGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 403 |
LEAP-Seq percent confirming: | 57.3036 |
LEAP-Seq n confirming: | 5551 |
LEAP-Seq n nonconfirming: | 4136 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGCACACACACACACACAC |
Suggested primer 2: | CTGTGTAGGAGGCTTGGAGC |