Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.235507 |
Chromosome: | chromosome 12 |
Location: | 5543128 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g531400 | NPHP4,NPH4,POC10 | (1 of 1) K16478 - nephrocystin-4 (NPHP4); Proteome of centriole protein 10 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTCAAGTCTACGTGACAACTTTGATTT |
Internal bar code: | GCCACCTATCCGTTCTCCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 466 |
LEAP-Seq percent confirming: | 99.2222 |
LEAP-Seq n confirming: | 1786 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACGATGTTGACCTTGATG |
Suggested primer 2: | CTACACTTTCGCCTTCCTCG |