| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.235629 |
| Chromosome: | chromosome 13 |
| Location: | 350525 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g564350 | ATM1 | (1 of 1) K04728 - ataxia telangiectasia mutated family protein (ATM, TEL1); Ataxia telangiectasia mutated protein 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGGGGCGTGCATGTTGCTCCGCATGGG |
| Internal bar code: | GTGGTTCGTCTCACGGCTTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 211 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTTCCAATCTAGGCACTG |
| Suggested primer 2: | ACCAAGCATCCCTGTCAATC |