| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.236806 |
| Chromosome: | chromosome 12 |
| Location: | 378651 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g494100 | SPL19 | Pre-mRNA splicing factor; (1 of 1) K12828 - splicing factor 3B subunit 1 (SF3B1, SAP155) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTGCAAACCATGCAGCCGCCAGCACTC |
| Internal bar code: | GAACGACGTCGTAAAGACTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 432 |
| LEAP-Seq percent confirming: | 99.4159 |
| LEAP-Seq n confirming: | 9701 |
| LEAP-Seq n nonconfirming: | 57 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACACATACACGAGCACGA |
| Suggested primer 2: | GGTGGTGGTGAGGAGTTGTT |