Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.236806 |
Chromosome: | chromosome 12 |
Location: | 378662 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g494100 | SPL19 | Pre-mRNA splicing factor; (1 of 1) K12828 - splicing factor 3B subunit 1 (SF3B1, SAP155) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCCAGTAACGCCCACACGTGTATTTGC |
Internal bar code: | GATCATGCCGCGCCGACTGCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 598 |
LEAP-Seq percent confirming: | 98.4741 |
LEAP-Seq n confirming: | 3872 |
LEAP-Seq n nonconfirming: | 60 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACACATACACGAGCACGA |
Suggested primer 2: | GGTGGTGGTGAGGAGTTGTT |