| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237409 |
| Chromosome: | chromosome 16 |
| Location: | 1239949 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g651050 | CYC6,PETJ | (1 of 2) K08906 - cytochrome c6 (petJ); Cytochrome c6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCGACCTGCCCCAACGTCGCCCCTCTC |
| Internal bar code: | AGGTTGACGCAATCGTCATTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 558 |
| LEAP-Seq percent confirming: | 95.962 |
| LEAP-Seq n confirming: | 808 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATATACGACTGCCCCTGG |
| Suggested primer 2: | GCTTCAAGGTGGAGAGCATC |