| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.237747 |
| Chromosome: | chromosome 3 |
| Location: | 5085339 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g181250 | SNE18,CGLD13 | (1 of 10) PF13460 - NAD(P)H-binding (NAD_binding_10); conserved protein related to nucleoside diphosphate sugar epimerase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAAACCCCTGTCGCCTTGGCCCCGATCCC |
| Internal bar code: | GGCTGCTAAAGTGCCGAGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 518 |
| LEAP-Seq percent confirming: | 98.7189 |
| LEAP-Seq n confirming: | 1387 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTACGACCTCAACACGCT |
| Suggested primer 2: | AAACTGCTTCACGTCCTGCT |