| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.237893 |
| Chromosome: | chromosome 12 |
| Location: | 4048281 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g517400 | RABF1,RAB5 | (1 of 1) K07889 - Ras-related protein Rab-5C (RAB5C); RAB-like GTP-Binding Protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCAGATGCCCGGGGCCAGCCAATGACA |
| Internal bar code: | TATCTAGGAATTGCGGGCGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 621 |
| LEAP-Seq percent confirming: | 98.3792 |
| LEAP-Seq n confirming: | 3824 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGGCCAAACCCTTATTAC |
| Suggested primer 2: | GAGCACCGGAGACTGCTTAC |