| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.238772 |
| Chromosome: | chromosome 6 |
| Location: | 6432884 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g292550 | PP1A,FAP15,PP1c,PP1C,PPP25 | (1 of 1) K06269 - serine/threonine-protein phosphatase PP1 catalytic subunit (PPP1C); Protein Phosphatase type-1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCTTTGACCTCGTTAGTGGACAGGTTC |
| Internal bar code: | GGCCGTTATTAACTTGCAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 499 |
| LEAP-Seq percent confirming: | 97.8667 |
| LEAP-Seq n confirming: | 367 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAAGCTTCCCTCAACTT |
| Suggested primer 2: | CCCACACACACACACAGACA |