| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.239030 |
| Chromosome: | chromosome 16 |
| Location: | 3890985 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g690250 | PUS18 | TruB family RNA pseudouridine synthase; (1 of 1) K03177 - tRNA pseudouridine55 synthase [EC:5.4.99.25] (truB, PUS4, TRUB1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCCGCACCACAAAGCGCGCCCGCACAC |
| Internal bar code: | ATCATCTGTCATTGAAGGGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 192 |
| LEAP-Seq percent confirming: | 98.9899 |
| LEAP-Seq n confirming: | 98 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGCATGAGCCCTAACTC |
| Suggested primer 2: | CCCTAGGTAGCGCACACAAT |