| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.239464 |
| Chromosome: | chromosome 3 |
| Location: | 1951536 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g155650 | CLC1 | Clathrin light chain; (1 of 1) PTHR10639 - CLATHRIN LIGHT CHAIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGACCATGCCCTGGCCCGCATTCCTGCCG |
| Internal bar code: | CGCCCAGAGTTAGTAGGCAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 99 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 223 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCTAAAGTTCAAACTCGC |
| Suggested primer 2: | AGTTTGAGGAGAAGCACCGA |